View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8154_low_5 (Length: 239)
Name: NF8154_low_5
Description: NF8154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8154_low_5 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 5 - 223
Target Start/End: Complemental strand, 32569933 - 32569715
Alignment:
| Q |
5 |
aaaatgaaaaatagtacttcaatttgcgtgatctgtttccgcttttatctgaatataaaa-ctaagacattttctagatttatcagtaacacagtttctg |
103 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32569933 |
aaaatgaaaaatagtacttcaaattgcgtgatctgttttggcttttatgtgaatataaaaactaagacaatttctagatttatcagtaacacagtttctg |
32569834 |
T |
|
| Q |
104 |
gcatgcagagtagttaattggggttggcagtagcaatatttgtttatgaaatcattgttgttatgttgttttccctgtttccaaatcccgtgagatatgt |
203 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
32569833 |
gcatgcagagtagttaattggggt-ggcagtagcaatatttgtttatgaaattattgttgtgatgttgttttccttgtttccaaatcctgtgagatatgt |
32569735 |
T |
|
| Q |
204 |
ttgttgttgaaggttggatt |
223 |
Q |
| |
|
||||||||||||| |||||| |
|
|
| T |
32569734 |
ttgttgttgaaggatggatt |
32569715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 74 - 223
Target Start/End: Original strand, 4136 - 4285
Alignment:
| Q |
74 |
tttctagatttatcagtaacacagtttctggcatgcagagtagttaattggggttggcagtagcaatatttgtttatgaaatcattgttgttatgttgtt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4136 |
tttctagatttatcagtaacacagtttctggcatgcagagtagttaattggggttggcagtagcaatatttgtttatgaaatcattgttgttatgttgtt |
4235 |
T |
|
| Q |
174 |
ttccctgtttccaaatcccgtgagatatgtttgttgttgaaggttggatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4236 |
ttccctgtttccaaatcccgtgagatatgtttgttgttgaaggttggatt |
4285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University