View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8155_high_4 (Length: 300)
Name: NF8155_high_4
Description: NF8155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8155_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 19 - 292
Target Start/End: Complemental strand, 41224155 - 41223882
Alignment:
| Q |
19 |
cgtgaaccatggaacatcccctaagatctcattgtttgaaacgtatgaaaacttggtatgcgaaattagcaaaagttgcactattgcactaaccaatcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
41224155 |
cgtgaaccatggaacatcccctaagatctcattgtttgaaacgtatgaaaacttggtatgagaaagtagcaaaagttgcactattgcactaaccaatcaa |
41224056 |
T |
|
| Q |
119 |
atccataaatttagcaagtgtgctatgttattcctcacaggcttcattgcaacttcattgaccatctctagtgtggtcttcactgagtcatcaatatttt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
41224055 |
atccataaatttagcaagtgtgctatgttattcctcacaggcttcattgcaacttcattgaccatctctagtgcggtcttcaccgagtcatcaatatttt |
41223956 |
T |
|
| Q |
219 |
cagccaaatgctctaacatgtagtatatataattagcaatacagtcactacactcaacattgacatcaacacga |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41223955 |
cagccaaatgctctaacatgtagtatatataattagcaatacagtcactacattcaacattgacatcaacacga |
41223882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University