View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8155_low_10 (Length: 202)
Name: NF8155_low_10
Description: NF8155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8155_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 9e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 9e-72
Query Start/End: Original strand, 23 - 190
Target Start/End: Original strand, 42011550 - 42011715
Alignment:
| Q |
23 |
aaccccacaaatgaattgtggcctttgaataaaggatatgtagcaccaaatttattagttctctccgatatgtattttatgtaaactgatctttagctct |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42011550 |
aaccccacaaatgaattgtggcctttgaataaaggatatgtagcaccaaatttattagttctctccgatatgtattttatgtaaactgatctttagctcc |
42011649 |
T |
 |
| Q |
123 |
tctcttattttcatcaatgttataagtcaggaaaaaatagaacaaacttaacaaagttcagaataata |
190 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
42011650 |
tctcttattttcatcaatgt--taagtcgggaaaaaatagaacaaacttaacaaaattcgaaataata |
42011715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University