View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8157_low_12 (Length: 400)
Name: NF8157_low_12
Description: NF8157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8157_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 8 - 383
Target Start/End: Complemental strand, 34443568 - 34443193
Alignment:
| Q |
8 |
gattattctccacattgtctagttgtgctgccattattacccgatgcagcttccatttgcaacaaaccattttgattcctcattggagttgaagttcctg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34443568 |
gattcttctccacattgtctagttgtgctgccattattacccgatgcagcttccatttgcaacaaaccattttgattcctcattggagttgaagttcctg |
34443469 |
T |
|
| Q |
108 |
aatgaattggacttctagtagtaggagttgttgctctaataggtgtagcagttcttgaaggctcttgacttgcaataggtgtcatttcagttcccacgtc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34443468 |
aatgaattggacttctagtagtaggagttgttgctctaataggtgtagcagttcttgaaggctcttgacttgcaataggtgtcatttcagttcccatgtc |
34443369 |
T |
|
| Q |
208 |
tctaaaacatattgattgaacatggattgtgtttttgttttctgctaaaaccttactattattattcattctccaaattgattcatcatcacattctacc |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34443368 |
tctaaaacatattgattgaacatggattgtgtttttgttttctgctaaaaccttactattattattcattctccaaattgattcatcatcacattctacc |
34443269 |
T |
|
| Q |
308 |
ttcttagagtcttctgcttcatattcactactagttgttgtcatgaagtcgcggcatccatcatcgtcgtgttctt |
383 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34443268 |
ttcttagagtcttctgcttcatattcactactagttgttgtcatgaagtcgtggcatccatcatcgtcgtgttctt |
34443193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University