View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8157_low_13 (Length: 397)
Name: NF8157_low_13
Description: NF8157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8157_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 378
Target Start/End: Original strand, 8765896 - 8766271
Alignment:
| Q |
1 |
gttagggtgggagtgggttttacctaggaatcttcaagaattgcttcatatgggttagtgtctttacgtagtaggtgtagggatatactaagatttacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8765896 |
gttagggtgggagtgggttttacctaggaatcttcaggaattgcttcat--gggttagtgtctttacgtagtaggcgtagggatatactaagatttacta |
8765993 |
T |
|
| Q |
101 |
tagtttggcattaaactgtgttatccatccggaaggcccgaaatgacattattttttctggtattgcccttgaggttgatattatggttgataagattca |
200 |
Q |
| |
|
|| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
8765994 |
tattttggcattaaactgtgtggtccatccggaaggcccgaaatgacattattttttctggtattgcccttgaggttgatattctggttgataagattca |
8766093 |
T |
|
| Q |
201 |
attcccttgttggaattggttcattgctaaacacccttcacactattgttgattttatgagtggaaggtggagtcaattctttgttggcgccattattgt |
300 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| || ||| |
|
|
| T |
8766094 |
attcctttattggaattggttcattgctaaacacccttcacactagtgttcattttatgagtggaaggtggagtcaattctttgttggcgccagtagtgt |
8766193 |
T |
|
| Q |
301 |
tcagtttgttgggggcagagctggatcttatctgtgctttgggcttttgggtggggacccgatttcgggtgtttgtct |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
8766194 |
tcagtttgttgggggcagagctggatcttatctgtgctttgggcttttgggtgggcacccgatttcgagtgtttgtct |
8766271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 254 - 286
Target Start/End: Original strand, 9500222 - 9500254
Alignment:
| Q |
254 |
tttatgagtggaaggtggagtcaattctttgtt |
286 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
9500222 |
tttatgagtggaaggtggagccaattctttgtt |
9500254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University