View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8157_low_18 (Length: 278)
Name: NF8157_low_18
Description: NF8157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8157_low_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 17 - 128
Target Start/End: Complemental strand, 43063397 - 43063287
Alignment:
| Q |
17 |
cacaaagttggctttgaatatgagattccttacgtctccacatataaacatagtgaatgggaaattttaaattgtcttcactatcacacggaatagaatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43063397 |
cacaaagttggctttgaatatgagat-ccttacgtctccacatataaacatagtgaatgggaaattttaaattgtcttcactatcacacggaatagaatt |
43063299 |
T |
|
| Q |
117 |
gtcttcatttca |
128 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43063298 |
gtcttcatttca |
43063287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 158 - 266
Target Start/End: Complemental strand, 43063267 - 43063158
Alignment:
| Q |
158 |
ggtttctctcctttttt-aatatccacgaggtattagacaatcatctttcnnnnnnnnttgaagaactattaaaggtattatcaaccnnnnnnncatgtt |
256 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
43063267 |
ggtttctctcctttttttaatatccacgaggtattagacgatcatctttcaaaaaaaattgaagagctattagaggtattatcaaccaaaaaaacatgtt |
43063168 |
T |
|
| Q |
257 |
atcatgtctc |
266 |
Q |
| |
|
|||||||||| |
|
|
| T |
43063167 |
atcatgtctc |
43063158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University