View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8157_low_19 (Length: 270)
Name: NF8157_low_19
Description: NF8157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8157_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 8 - 254
Target Start/End: Original strand, 35949839 - 35950084
Alignment:
| Q |
8 |
tcgtgttgatgtgttgcctccttgatctctgattcttcaatatctattgagatctgcagttttcttggctttggttcgtcgcccccaatgtcggtgggtt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35949839 |
tcgtgttgatgtgttgcctccttgatctctgattctttcatatctattgagatctgcagttttcttggctttggtttgtcgcccccaatgtcggtgggt- |
35949937 |
T |
|
| Q |
108 |
gggggtggtattgggaaggtgttgatgcctcatgcttcaggctcgtggccttcatccttctcaaatttggttcagtctgtagcgattgaattcagactct |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
35949938 |
gggggtggtattgggaaggtgttgatgcctcatgcttcaggctcgtggccttcatccttctcaaattcggttcagtctttagtgattgaattcagactct |
35950037 |
T |
|
| Q |
208 |
tgggtctgaaatggttgttaatttgttgtttatgtcggtaaagaatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35950038 |
tgggtctgaaatggttgttaatttgttgtttatgtcggtaaagaatt |
35950084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 86
Target Start/End: Complemental strand, 14541654 - 14541580
Alignment:
| Q |
12 |
gttgatgtgttgcctccttgatctctgattcttcaatatctattgagatctgcagttttcttggctttggttcgt |
86 |
Q |
| |
|
||||||||||||| |||||||||| ||||| || | |||||||||||| ||||| |||||| | ||||||||| |
|
|
| T |
14541654 |
gttgatgtgttgcttccttgatcttcgattcatctagatctattgagatatgcagctttcttaacattggttcgt |
14541580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University