View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8158_high_1 (Length: 353)
Name: NF8158_high_1
Description: NF8158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8158_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 7500209 - 7500541
Alignment:
| Q |
1 |
tggagtaccccacctcaatcttcgtcaacatctggttaacccaaagaggtttacaactagaatgaaacaagcctgcagcacggttttgtattgtgtcgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500209 |
tggagtaccccacctcaatcttcgtcaacatctggttaacccaaagaggtttacaactagaatgaaacaagcctgcagcacggttttgtattgtgtcgat |
7500308 |
T |
 |
| Q |
101 |
aactacccaactcaacctcaaattttcatgcaaatattccgtccagtcccatctctctttctttaccggaatttgagtttccagagaggaatagtctctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500309 |
aactacccaactcaacctcaaattttcatgcaaatattccgtcctgtcccatctctctttctttaccggaatttgagtttccagagaggaatagtctctt |
7500408 |
T |
 |
| Q |
201 |
nnnnnnntcttaccgttggagtatatagtgaatttgttcataggttgaacttggatcttagtgaacaaaggctttggctctccatgtaaagatatatcaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7500409 |
aaaaaaatcttaccgttggagtatatagtgaatttgttcataggttgaactcggatcttagtgaacaaaggctttggctctccatgtaaagatatatcaa |
7500508 |
T |
 |
| Q |
301 |
tggcatggatcaatttatttatgggacgataca |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7500509 |
tggcatggatcaatttatttatgggacgataca |
7500541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 96 - 140
Target Start/End: Complemental strand, 8057726 - 8057682
Alignment:
| Q |
96 |
tcgataactacccaactcaacctcaaattttcatgcaaatattcc |
140 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | ||| |||||| |
|
|
| T |
8057726 |
tcgataaccacccaactcaacctcaaattttctttcaagtattcc |
8057682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 96 - 139
Target Start/End: Complemental strand, 27257839 - 27257796
Alignment:
| Q |
96 |
tcgataactacccaactcaacctcaaattttcatgcaaatattc |
139 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
27257839 |
tcgataacaacccaactcaacctcaaattttcttgcaaatattc |
27257796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University