View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8160_low_10 (Length: 317)
Name: NF8160_low_10
Description: NF8160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8160_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 4 - 298
Target Start/End: Original strand, 4280943 - 4281237
Alignment:
| Q |
4 |
gagtttggagttgcataaactgattagttcggggcagtccacttgctactatgatccaaatttaggtctttctcaactttcatagatttattttgaattc |
103 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4280943 |
gagtttgcagttgcataaactgattagttcggggcagtccacttgctactatgatccaaatttaggtctttctcaactttcatagatttattttgaattc |
4281042 |
T |
 |
| Q |
104 |
atttgttagnnnnnnncataaagttttcaaatataataaattgatgtacaatttcctttaaacatgttaaaacattacaatgttctattgtcacatatgc |
203 |
Q |
| |
|
||||||||| |||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4281043 |
atttgttagaaaaaaacataaagtttgcaaatataataacttgatgtacaatttcctttaaacatgttaaaacattacaatgttctattgtcacatatgc |
4281142 |
T |
 |
| Q |
204 |
agggcatgattttgttgacactatcagtctcggtatggaaaaacaagaagctgttcttcatcgcgctttacgcgttgtctgtcggtgatggcggg |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4281143 |
agggcatgattttgttgacactatcagtctcggtatggaaaaacaagaagctgttcttcatcgcgctttacgcgttgtctgtcggtgatggcggg |
4281237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University