View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8160_low_16 (Length: 247)
Name: NF8160_low_16
Description: NF8160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8160_low_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 233
Target Start/End: Original strand, 37820662 - 37820880
Alignment:
| Q |
15 |
atgaatatgagtaagacaagatgtattgttgaatgcttgtaaccaaacagaaaatcgtgctctcagcctcaaggtacacgaatagtccaagcaaaaattg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37820662 |
atgaatatgagtaagacaagatgtattgttgaatgcttgtaaccaaacagaaaatcgtgctctcagcctcaaggtacacgaatagtccaagcaaaaattg |
37820761 |
T |
 |
| Q |
115 |
agaggacatgcttgtcaacatgatagcatgaattttagttcacacaatttataagattattacataattaaaactatcagttttgcctttatctgaaatt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37820762 |
agaggacatgcttgtcaacatgatagcatgaattttagttcacacaatttataagattattacataattaaaactatcagttttgcctttatctgaaatt |
37820861 |
T |
 |
| Q |
215 |
tgacgtctatgattattgt |
233 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37820862 |
tgacgtctatgattattgt |
37820880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University