View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8161_high_6 (Length: 288)
Name: NF8161_high_6
Description: NF8161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8161_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 1 - 270
Target Start/End: Original strand, 23971373 - 23971642
Alignment:
| Q |
1 |
ttaagggaagattaaatcgtaccttagagaatttattaatcgtcgagccttgcacattaaagtctgaaggaggtgtttcagtttccttggggatatatga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
23971373 |
ttaagggaagattaaatcgtaccttagagaatttattaatcgtcgagccttgcacattaaagtgtgaaggaggtgtttcagtttccttggggatatatga |
23971472 |
T |
 |
| Q |
101 |
ggctccttacaattgcaagcacaccttcatgtggtatggaggtgttaatagcttagtttgggtcctagcatggctagcaaggctttttgggaagtctaga |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23971473 |
ggctccttacagttgcaagcacaccttcatgtggtatggaggcgttaatagcttagtttgggtcctagcatggctagcaaggctttttgggaagtctaga |
23971572 |
T |
 |
| Q |
201 |
acaattaccccccaagtcatcattctggtagtgaagagtgatgacttcaagaagttttatgtttataaag |
270 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23971573 |
acaattaccccccaagtcatcattctggcagtgaagagtgatgacttcaagtagttttatgtttataaag |
23971642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University