View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8161_high_7 (Length: 284)
Name: NF8161_high_7
Description: NF8161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8161_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 68 - 278
Target Start/End: Original strand, 1488674 - 1488880
Alignment:
| Q |
68 |
taacaaatttctaagcaagaaaaatatttgataaccgatattgcaaagttcagtnnnnnnnttatatgctcaatttactttcnnnnnnnnctaacccttg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
1488674 |
taacaaatttctaagcaagaaaaatatttgataaccgatactgcaaagttcagtaaaaaaattatatgctcaatttactttcttttttttctaacccttg |
1488773 |
T |
|
| Q |
168 |
gaagagagtgttgagtttctgttgtatagagtagatagaaccatgacagatcaaagcatattaccattatacaagaatatatgaacttgttggtacactt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
1488774 |
gaagagagtgttgagtttctgttgtatagagtaga----accatgacagatcaaagcatattaccattatacaagaatatatgaacttgttggtacaatt |
1488869 |
T |
|
| Q |
268 |
gcaacaccaaa |
278 |
Q |
| |
|
||||||||||| |
|
|
| T |
1488870 |
gcaacaccaaa |
1488880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Original strand, 1488654 - 1488696
Alignment:
| Q |
23 |
gtgcgtacatttactttttgtaacaaatttctaagcaagaaaa |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1488654 |
gtgcgtacatttactttttgtaacaaatttctaagcaagaaaa |
1488696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 238 - 278
Target Start/End: Original strand, 3381515 - 3381555
Alignment:
| Q |
238 |
acaagaatatatgaacttgttggtacacttgcaacaccaaa |
278 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3381515 |
acaagaatatatgaacttgttgatacacttgcaacaccaaa |
3381555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 245
Target Start/End: Original strand, 3381304 - 3381384
Alignment:
| Q |
163 |
ccttggaagagagtgttgagtttctgttgtatagagtagatagaaccatgacagatc--aaagcatattaccattatacaagaat |
245 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||| ||||||||||| ||||| ||||||||||||||| ||||| |||| |
|
|
| T |
3381304 |
ccttcgaagagagtgttgagtttctattgtataga----ctagaaccatgaaagatcataaagcatattaccatgatacaggaat |
3381384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University