View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8161_low_10 (Length: 295)
Name: NF8161_low_10
Description: NF8161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8161_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 12922942 - 12922667
Alignment:
| Q |
1 |
taaaacttgtaacttcagggagttagacaaggcttgccactagcacatgaatgtactttttaattcaaatgcatgtggaaataggacattcagaattagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12922942 |
taaaacttgtaacttcagggagttagacaaggcctgccactagtacatgaatgtactttttaattcaaatgcatgtggaaatatgacattcagaattagc |
12922843 |
T |
|
| Q |
101 |
tttacttaaagcaaaatataatgtatcagcaaaatttattttaggacactactatgttatgtttgggttttagaactgggagacataagtagggtgtcta |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12922842 |
tttacttaaagcaaaatataaggtatcagcaaaatttattttaggacactactatgttatgtttgggtttaagaactgggagacataagtagggtgtcta |
12922743 |
T |
|
| Q |
201 |
tctactttaactgattgtttctgttcctttgcttaaacctcggaagatgaatggctgttactttgcactagctaac |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12922742 |
tctactttaactgattgtttctgttcctttgcttaaacctcggaagatgaatggctgttactttgcactagctaac |
12922667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University