View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8161_low_13 (Length: 270)
Name: NF8161_low_13
Description: NF8161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8161_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 33852466 - 33852215
Alignment:
| Q |
1 |
atttgatttaagattttcactgaattttaataacatat--tttgcgacaaggttttcacttttaaaggnnnnnnnntaaaatataattgttatgaatatc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||| ||||| ||| |||||||||||| ||| |||||| ||||||||| ||| |
|
|
| T |
33852466 |
atttgatttaagattttcactgaattttaataacaaatagtttgccacaagctttacacttttaaaggaaaaaaa-taatatataagtgttatgaagatc |
33852368 |
T |
 |
| Q |
99 |
tttcaaaatttcttataaaaccaactttctgaatttattgagtttaaagtaagactcagtacactataattaatatcatggtggtataattaaaaacctc |
198 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33852367 |
tttcaaaatttcttataaaaccaactctctgaatttatggagtttaaagtaagactcagtacactataattaaaatcatggtggtataattaaaaacctc |
33852268 |
T |
 |
| Q |
199 |
atcagtgacacaatattagatgccctctgatgtcactcttgcaagaataatct |
251 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| |||||| |||||||| |
|
|
| T |
33852267 |
atcagtgacacagtattagatgccctttgatgtcactgttgcaataataatct |
33852215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University