View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8161_low_15 (Length: 254)
Name: NF8161_low_15
Description: NF8161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8161_low_15 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 254
Target Start/End: Complemental strand, 12923185 - 12922943
Alignment:
| Q |
14 |
attattctgcttcatctaatgccatagagactgttacctaacacgttacaagagagaatggcaaagaatgctgatagaagagtgatactgattaaatttt |
113 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12923185 |
attatcctgcttcatctaatgccacagagactgttacctaacacgttacaagagagaatggcaaagaatgctgatagaagagtgacactgattaaatttt |
12923086 |
T |
 |
| Q |
114 |
ataggttttatccttttacagagagtgaaattaaagctatttgttatttataagattcactgatccatctcgaaatataataagatttactgataccagt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12923085 |
ataggttttatccttttacagagagtgaaattaaagatatttgttatttataagattcactgatccatctcaaaatataataagatttactgataccagt |
12922986 |
T |
 |
| Q |
214 |
atttggaaaatga--ctcttttttcacttgttcaccctgctgg |
254 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12922985 |
atttggaaaatgactctcttttttcacttgttcaccctgctgg |
12922943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University