View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8161_low_16 (Length: 248)
Name: NF8161_low_16
Description: NF8161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8161_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 40211316 - 40211089
Alignment:
| Q |
1 |
cagtttggaacaccaccctttcctccattgctttcattgacacgacaccaaggtaccgtcaacccaacaacattgtttttgacgccatgcatttgnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40211316 |
cagtttggaacaccaccctttcctccattgctttcattgacacgacaccaaggtaccgtcaacccaacaacattgtttttgacgccatgcatttgtttta |
40211217 |
T |
 |
| Q |
101 |
nnnnnnnnnnnnnnnnngaattaaagctgaaacagaattacaactgaacagctaggaccactcaaacaagtttttaaccctacagactttgaaagtatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40211216 |
ttttttatttttttt--gaattaaagctgaaacagaattacaactgaacagctaggaccactcaaacaagtttttaaccctacagactttgaaagtatag |
40211119 |
T |
 |
| Q |
201 |
ctagtttttgttttctgtaggggctgctac |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40211118 |
ctagtttttgttttctgtaggggctgctac |
40211089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University