View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8161_low_18 (Length: 241)
Name: NF8161_low_18
Description: NF8161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8161_low_18 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 20311319 - 20311543
Alignment:
| Q |
19 |
aattgtacgttttaaccaat--tcatagtaacttcaatgatatgaagtttattgtgctatgttttttgactcccaaaagaatgtaatgtaatgtaaaagt |
116 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20311319 |
aattttacgttttaaccaatattcatagtagcttcaatgatatgaagtttattgtgctatgttttttgactcccaaaagaatgtaatgtaatgtaaaagt |
20311418 |
T |
 |
| Q |
117 |
tgtgttttgctttttctaaatgaaacaaggtgaattcactgcaaatgttacagaaccataggtaggttcctagtgttgccccagtattaggagtttgaga |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20311419 |
tgtgttttgctttttctaaatgaaacaaggtgaattcactgcaaatgttgcagaaccataggtaggttcctagtgttgccctagtattaggagtttgaga |
20311518 |
T |
 |
| Q |
217 |
agtgtcaccccattgaactttagtt |
241 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
20311519 |
agtgtcaccccattgaactttagtt |
20311543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University