View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8161_low_7 (Length: 347)
Name: NF8161_low_7
Description: NF8161
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8161_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 19 - 245
Target Start/End: Original strand, 40184413 - 40184627
Alignment:
| Q |
19 |
atgaagctcaaacatctctgagattacctgtttggcaattaaa-aatgatcagtgttccaaacaaaagttttccatttcttcgacacgccttatatactc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40184413 |
atgaagctcaaacatctctgagattacctctttggcaattaaagaatgatcagtgtt-------------ttccatttcttcgacacgccttatatactc |
40184499 |
T |
|
| Q |
118 |
tttgaacgcatccaagacacatatatgttggttataaagatatgtcaaaacaatgatgatcaatgggagtcaaaaatattaaatttgattacataatttt |
217 |
Q |
| |
|
||| ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
40184500 |
tttaaacgcatccaaaacacatatacgttggttataaagatatgtcaaaacaatgatgatcaatgagagtcaaaaatattaaatttgattacatcatttt |
40184599 |
T |
|
| Q |
218 |
aaactttcatagtagataggtgaatgta |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40184600 |
aaactttcatagtagataggtgaatgta |
40184627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 298 - 336
Target Start/End: Original strand, 40184627 - 40184665
Alignment:
| Q |
298 |
atttagatacacatgtatattttgaagtgttcgtgtgtg |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40184627 |
atttagatacacatgtatattttgaagtgttcgtgtgtg |
40184665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University