View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8162_low_4 (Length: 397)
Name: NF8162_low_4
Description: NF8162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8162_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 19 - 371
Target Start/End: Original strand, 103789 - 104142
Alignment:
| Q |
19 |
cttgttgttgttgagtcgcctgcatagcatcatataatatattttacgatcaaagaaagttgtgtccaccgacacatgtgattacattcaatgaaagaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
103789 |
cttgttgttgttgagtcgcctgcatagcatcatataatatattttacgatcaaagaaagttgtgtccatcgacacatgtgattacattccatgaaagaat |
103888 |
T |
 |
| Q |
119 |
caagtgtctcatattattatctgcgccgacttgtctccgtgtcagtgtcagggcttcatagctcaatcacgtatttaattcttgtgaataaattgtaata |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103889 |
caagtgtctcatattattatctgcgccgacttgtctccgtgtcagtgtcagcgcttcatagctcaatcacgtatttaattcttgtgaataaattgtaata |
103988 |
T |
 |
| Q |
219 |
acttacaagaatttgatattagagaggttagagagggtggga-ggatagaggcagtgagattgttgtggtaaagacccaagctaattaggttcttcaggt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103989 |
acttacaagaatttgatattagagaggttagagagggtgggagggatagaggcagtgagattgttgtggtaaagacccaagctaattaggttcttcaggt |
104088 |
T |
 |
| Q |
318 |
ttccaagctcttttggtattggacccaccaattcattcttgtacaattctctgc |
371 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
104089 |
ttccaagctcttttggtattggacccaccaattcattctcgtacaattctctgc |
104142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University