View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8162_low_5 (Length: 372)
Name: NF8162_low_5
Description: NF8162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8162_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 15 - 360
Target Start/End: Original strand, 19096928 - 19097274
Alignment:
| Q |
15 |
atcaggattaactagaagaagctcgactaggaacggtagtgggaggggaagggggaggccgaggcggcaaacacaggttaccccttcttcctcaccacct |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19096928 |
atcaggattaactagaagaagctcgactaggaacggtagtgggaggggaagggggaggccgaggcggcaaacacaggttaccccttcttcctcaccacct |
19097027 |
T |
 |
| Q |
115 |
gttgtcaccaatgaaagcagcactccgttgacgcagcaactcaata-cattgaagtggcgtttgaggataggagcctaacaggttggggtaaaacaactc |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097028 |
gttgtcaccaatgaaagcagcactccgttgacgcagcaactcaataacattgaagtggcgttggaggataggagcctaacaggttggggtaaaacaactc |
19097127 |
T |
 |
| Q |
214 |
gaaggcctcgaagacaaaggggtccaccggctggtaatcctctgttgatcccaattacataatcatcataagaggcttaaaatttttagatgagaattta |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097128 |
gaaggcctcgaagacaaaggggtccaccggctggtaattctctgttgatcccaattacataatcatcataagaggcttaaaatttttagatgagaattta |
19097227 |
T |
 |
| Q |
314 |
tagaggtaagcattggcagtttccatatttgatggagcacatgatgt |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19097228 |
tagaggtaagcattggcagtttccatatttgatggagcacatgatgt |
19097274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University