View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8163_high_12 (Length: 303)
Name: NF8163_high_12
Description: NF8163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8163_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 159 - 272
Target Start/End: Original strand, 1716927 - 1717040
Alignment:
| Q |
159 |
gttgaacagaaagtacctgtgagcatgcaaatggaatttccaggaaatcccaacttgtcaatcagaaaatgtttcatgcaccgagcattattcacagaac |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1716927 |
gttgaacagaaagtacctgtgagcatgcaaatggaatttccaggaaatcccaacttgtcaatcagaaaatgtttcatgcaccgagcattattcacagaac |
1717026 |
T |
 |
| Q |
259 |
ctttaagcttcttc |
272 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1717027 |
ctttaagcttcttc |
1717040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 22 - 97
Target Start/End: Original strand, 1716790 - 1716865
Alignment:
| Q |
22 |
aaccaaccacctcatggccatccgcatgttactttttgatggaattgtgtttttctcctctgaatcatctacaggt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1716790 |
aaccaaccacctcatggccatccgcatgttactttttgatggaattgtgtttttctcttctgaatcatctacaggt |
1716865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University