View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8163_high_19 (Length: 247)
Name: NF8163_high_19
Description: NF8163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8163_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 41 - 229
Target Start/End: Original strand, 3815951 - 3816139
Alignment:
| Q |
41 |
gcccgggatgcaaggattgcaagcggtggcgtttcgcatatcaggggacaaagcatacttctccggatgtggcttccatggtgcacaagacacactttgc |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3815951 |
gcccgggatgcaaggattgcaagcggtggcgtttcgcatatcaggggacaaagcatacttctccggatgtggcttccatggtgcacaagacacactttgc |
3816050 |
T |
 |
| Q |
141 |
gacgatgctggtaggcattacttcaaggaatgctacattgagggctccattgatttcatttttggaaatggaagatccatgtacaaggt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3816051 |
gacgatgctggtaggcattacttcaaggaatgctacattgagggctccattgatttcatttttggaaatggaagatccatgtacaaggt |
3816139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University