View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8163_high_21 (Length: 239)
Name: NF8163_high_21
Description: NF8163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8163_high_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 239
Target Start/End: Original strand, 43150224 - 43150446
Alignment:
| Q |
17 |
aatgacacatgtaattgcgtgtgatccataaacattcacaatttcccaacagctagctacgaaacagccatgcatacaagaacacaatagcttaaggcat |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43150224 |
aatggcacatgtaattgcgtgtgatccataaacattcacaatttcccaacagctagctacgaaacagccatgcatacaagaacacaatagcttaaggcat |
43150323 |
T |
 |
| Q |
117 |
acgcaatgaacgaaattataagacacatttgattttcaacaatttacctgtccacaaatagatataatatgtcccctcttctatgcatttgcaccaaaca |
216 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43150324 |
acgcaatgaacgaacttataagacacatttgattttcaacaatttacctgtccacaaatagatgtaatatgtcccctcttctatgcatttgcaccaaaca |
43150423 |
T |
 |
| Q |
217 |
nnnnnnncccttttgattactat |
239 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43150424 |
tttttttcccttttgattactat |
43150446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University