View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8163_low_16 (Length: 286)
Name: NF8163_low_16
Description: NF8163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8163_low_16 |
 |  |
|
| [»] scaffold0018 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 39151 - 38937
Alignment:
| Q |
1 |
tttccgactcttgttttgtttctaagttttaatctaagaatctgaaagaggcattaactcataagttctggataaatgttatgc------aagaggaact |
94 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39151 |
tttccaactcttgttttgtttctaagttttaatctaagaatgtgaaagaggtcttaactcataagttctggataaatgttatgcttatgcaagaggaact |
39052 |
T |
 |
| Q |
95 |
tggtcaatacaagagaaa-tgcaatttggaaattggttcctatagcggaacggttgaatgtcattgatgctaattggatttataagaacaagtatgatga |
193 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
39051 |
tggtcaatacaagagaaaatgcagtttggaaattggttcctatagcggaacagttgaatgtcattgatgctaattggatctataagaacaagtatgatga |
38952 |
T |
 |
| Q |
194 |
aagtggcattgtaac |
208 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38951 |
aagtggcattgtaac |
38937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 201 - 270
Target Start/End: Complemental strand, 38059 - 37990
Alignment:
| Q |
201 |
attgtaactatgaacaaggttcgcttagtggctcaaggatgcagcaaaggtgaaattgacaagaccttgt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38059 |
attgtaactatgaacaaggttcgcttagtggctcaaggatgcagcaaaggtgaaattgacaagaccttgt |
37990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 202 - 270
Target Start/End: Original strand, 17535806 - 17535874
Alignment:
| Q |
202 |
ttgtaactatgaacaaggttcgcttagtggctcaaggatgcagcaaaggtgaaattgacaagaccttgt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
17535806 |
ttgtaactatgaacaaggttcgcttagtggctcagggatgcagcaaaggtggaattgacaagaccttgt |
17535874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University