View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8164_low_6 (Length: 238)
Name: NF8164_low_6
Description: NF8164
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8164_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 7309970 - 7309764
Alignment:
| Q |
1 |
ttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaccacatcaagcgacaagcatgaatgatggaacatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
7309970 |
ttgaatttcgctctattgttgaaattggttcattttgaattgtagatctacaacctgagcttcaaacacatcaagc-------atgaatgatggaacatg |
7309878 |
T |
|
| Q |
101 |
gcggcagaatgttatgaagaaaaatattgcagcttattggaacttgtttgtttattgtactaattttacagagcctattttcacccgagctaaaactcca |
200 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7309877 |
gcggcagaatgctatgaagcaaaatattgcagctttttggaacttgtttgtttattgtactaattttatagagcctattttcacccgagctaaaactcca |
7309778 |
T |
|
| Q |
201 |
ttgctatttatgag |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7309777 |
ttgctatttatgag |
7309764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 86 - 200
Target Start/End: Original strand, 7330063 - 7330181
Alignment:
| Q |
86 |
gaatgatggaacatggcggcagaatgttatgaagaaaaatattgcagcttattgg------aacttgtttgtttattgtactaattttacagagcctatt |
179 |
Q |
| |
|
|||||||||| |||||| || ||||| ||||||||||||||||| |||||||||| |||||||||| |||||||||| ||||| | || ||||| |
|
|
| T |
7330063 |
gaatgatggagcatggctgcggaatgctatgaagaaaaatattggagcttattggaactacaacttgtttggttattgtactcatttt--atagtctatt |
7330160 |
T |
|
| Q |
180 |
ttcacccgagctaaaactcca |
200 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7330161 |
ttcacccgagctaaaactcca |
7330181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 14 - 58
Target Start/End: Original strand, 7330012 - 7330056
Alignment:
| Q |
14 |
tattgttgaaattggttcattttgaattgtagatctacaacctga |
58 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7330012 |
tattgtttaaatgggttcattttgaattgtagatctacaacctga |
7330056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University