View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8166_high_8 (Length: 350)
Name: NF8166_high_8
Description: NF8166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8166_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 11 - 334
Target Start/End: Original strand, 5684839 - 5685162
Alignment:
| Q |
11 |
cagagacattacaggatgataatcctgctaaacagtttgatactttgttgtatttggcttttcagcatccttcgtgtgagagaacgaagcagaagcatgt |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684839 |
cagagacattagaggatgataatcctgctaaacagtttgatactttgttgtatttggcttttcagcatccttcgtgtgagagaacgaagcagaagcatgt |
5684938 |
T |
|
| Q |
111 |
taggtctgggcattccaggttgtttttcttagggcaatatgtgctggaattggcattggctgaattctttttgcagaggtatccgagggaattgcctggt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5684939 |
taggtctgggcattccaggttgtttttcttagggcaatatgtgctggaattggcattggctgaattctttttgcagaggtatccgagggaattgcctggt |
5685038 |
T |
|
| Q |
211 |
ccgatgagggagagagtttatgggttgattgggaaggagaatttgcctaaatggattaaagctgccagtttacagaatttgatatttccttatgataata |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685039 |
ccgatgagggagagagtttatgggttgattgggaaggagaatttgcctaaatggattaaagctgccagtttacagaatttgatatttccttatgataata |
5685138 |
T |
|
| Q |
311 |
tggataagattgtgaggagggata |
334 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
5685139 |
tggataagattgtgaggagggata |
5685162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 39772691 - 39772639
Alignment:
| Q |
28 |
gataatcctgctaaacagtttgatactttgttgtatttggcttttcagcatcc |
80 |
Q |
| |
|
||||| |||||||| || |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
39772691 |
gataaccctgctaagcaatttgatacgctgttgtatttggcgtttcagcatcc |
39772639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University