View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8166_low_15 (Length: 292)
Name: NF8166_low_15
Description: NF8166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8166_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 7 - 275
Target Start/End: Original strand, 52036135 - 52036414
Alignment:
| Q |
7 |
ttggtgttgcacaaattcactatacacaggttcagatcaatacaaccatcgatgcatcaaacatgaataatttctacaaccatatgattattttaactac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52036135 |
ttggtgttgcacaaattcactatacacaggttcagattaatacaaccattgatgcatcaaacatgaataatttctacaaccatatgattattttaactac |
52036234 |
T |
|
| Q |
107 |
nnnnnnnnn-gtctcaagatatagcaa----------ccgtaatttaaaaccatgttatctccgaaaacacttctataaaaattatatcattgcttgagt |
195 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52036235 |
aaaaaaaaaagtctcaagatatagcaaaaggtatgaaccgtaattgaaaaccatgttatctccgaaaacacttctataaaccttatatcattgcttgagt |
52036334 |
T |
|
| Q |
196 |
gttttagctgaaggtgcagcatatctagcagagaaaccgcggcctaaagcttcttcgtcgtcctcctcccaactaccatc |
275 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52036335 |
gttttagctgaagatgcagcatatctagcagagaaaccgcggcctaaagcttcttcgtcgtcctcctcccaactaccatc |
52036414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University