View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8166_low_21 (Length: 250)
Name: NF8166_low_21
Description: NF8166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8166_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 5 - 235
Target Start/End: Original strand, 44159673 - 44159888
Alignment:
| Q |
5 |
agtaacatggaatcacattaaatatcaatgaaaagcaattcattcatctttgtcaaataaaccaacgataatggaacaccaccaatagaaagcttataca |
104 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44159673 |
agtaacatggaatcacattaaatatcagtgaaaagcaattcattcatctttgtcaaataaaccaacgataatggaacaccaccaatagaaagcttataca |
44159772 |
T |
|
| Q |
105 |
ccaccaaacaaaccccaacgataatagaaagttttaaacttcaaaatacatccaaataaacccaaacaaatggaaaacaaacacatggaaatcaattcct |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44159773 |
ccaccaaacaaaccccaacgataatagaaagttttaaacttcaaaatacatccaaataaacccaaacaa---------------atggaaatcaattcct |
44159857 |
T |
|
| Q |
205 |
tcttctgaatattatatgtcattggctattt |
235 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |
|
|
| T |
44159858 |
tcttatgaatattatatgtcattggctattt |
44159888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University