View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8166_low_22 (Length: 243)
Name: NF8166_low_22
Description: NF8166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8166_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 15 - 220
Target Start/End: Complemental strand, 1262197 - 1261991
Alignment:
| Q |
15 |
agcagagaagttattatcacaactctgacttgcgaccaaccggttcatctatgcacactgtacaaagcatcaactctagtcaaggaccaacatatccatc |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1262197 |
agcagagaagttattatcacaactctgacttgcgaccaaccagttcatctatgcacactgtacaaagcatcaactctagtcaaggaccaacatatccatc |
1262098 |
T |
 |
| Q |
115 |
cgaagaaatcatattttgaaacgaataga-attattannnnnnngaaccaaggatgcttctaaacccccttgctccacggatgtcgaaaagctgattcct |
213 |
Q |
| |
|
||||||||||||||||||||||||| ||| || || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1262097 |
cgaagaaatcatattttgaaacgaaaagatttttttttttttttgaaccaaggatgcttctaaaaccccttgctccacggatgtcgaaaagctgattcct |
1261998 |
T |
 |
| Q |
214 |
ttgccaa |
220 |
Q |
| |
|
||||||| |
|
|
| T |
1261997 |
ttgccaa |
1261991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University