View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8166_low_23 (Length: 240)

Name: NF8166_low_23
Description: NF8166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8166_low_23
NF8166_low_23
[»] chr6 (1 HSPs)
chr6 (1-99)||(9660790-9660888)


Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 9660790 - 9660888
Alignment:
1 ccacgtcatatttaagattaaatattttttaaagtggattcaaaattttaaataataattttctcttctagaaagtggattagccaatacctaaacacg 99  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||  ||||| ||| ||||||||||||||||||||    
9660790 ccacgtcatatttaagattaaatgttttttaaagtggattcaaaattttaaatattaattttctcttacagaaaatgggttagccaatacctaaacacg 9660888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University