View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8166_low_27 (Length: 218)
Name: NF8166_low_27
Description: NF8166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8166_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 10 - 201
Target Start/End: Complemental strand, 42172674 - 42172483
Alignment:
| Q |
10 |
agcagagagaaattcatcagaaattaccagttcatctaactatgaattgagaagaggaatggttctaccgtttcaaccgctttcaatggcattcaatcat |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42172674 |
agcagtgagaaattcatcagaaattaccagttcatctaaccatgaattgagaagaggaatggttctaccgtttcaaccgctttcaatagcattcaatcat |
42172575 |
T |
|
| Q |
110 |
attagctactacatagacatgccagcagtaagtcactcaactttaagcagataattattctgttattgtactatgtggctttgtctaatatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42172574 |
attagctactacatagacatgccagcagtaagtcactcaactttaagcagataattattctgttattgtactatgtggctttgtctaatatg |
42172483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 28 - 148
Target Start/End: Complemental strand, 42154610 - 42154490
Alignment:
| Q |
28 |
agaaattaccagttcatctaactatgaattgagaagaggaatggttctaccgtttcaaccgctttcaatggcattcaatcatattagctactacatagac |
127 |
Q |
| |
|
|||||||| |||||||| ||| ||||| |||||||||||||||||||||||||||||| ||||| ||| ||||||| |||||||||||||| ||||| |
|
|
| T |
42154610 |
agaaattatgagttcatcgaaccatgaaccgagaagaggaatggttctaccgtttcaacctctttcgatgacattcaaccatattagctactatgtagac |
42154511 |
T |
|
| Q |
128 |
atgccagcagtaagtcactca |
148 |
Q |
| |
|
|||||||| |||||| ||||| |
|
|
| T |
42154510 |
atgccagccgtaagttactca |
42154490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 58 - 149
Target Start/End: Complemental strand, 42142781 - 42142690
Alignment:
| Q |
58 |
gagaagaggaatggttctaccgtttcaaccgctttcaatggcattcaatcatattagctactacatagacatgccagcagtaagtcactcaa |
149 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||| |||||| |||||| |
|
|
| T |
42142781 |
gagaagaggaatggtgctaccgtttcaacctctttcaatggaattcaatcatattagctactacgtagacatgccagacgtaagttactcaa |
42142690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University