View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8167_high_2 (Length: 228)
Name: NF8167_high_2
Description: NF8167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8167_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 210
Target Start/End: Original strand, 36599144 - 36599338
Alignment:
| Q |
17 |
agacagagacatatataattgctcctttt-tcagtttctattatttacggaggatattaacaaacttcaatcgtctccgttgttgagagtctgctcttga |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
36599144 |
agacagagacatatataattgctccttttttcagtttctattatttacggaggatattaacaaacttcagtcgtctccgctgttgagagtctgctcttga |
36599243 |
T |
|
| Q |
116 |
tcagtgcttggtcgggcaaaattttctttgtttgtgcagtgtttatgcaacaaccttatatggcagcttatcactattcttcacggtgaagtttg |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36599244 |
tcagtgcttggtcgggcaatattttctttgtttgtgcagtgtttatgcaacaaccttatatggcagcttatcactattcttcacggtggagtttg |
36599338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University