View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8169_high_15 (Length: 293)
Name: NF8169_high_15
Description: NF8169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8169_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 278
Target Start/End: Original strand, 52565239 - 52565516
Alignment:
| Q |
1 |
caatcaagaagctgatcaggatggtacttcggtgaagtggatgtcttcaaagatgagaataatgaagaagatgatgatttctgatcaaacgggcagttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52565239 |
caatcaagaagctgatcaggatggtacttcggtgaagtggatgtcttcaaagatgagaataatgaagaagatgatggtttctgatcaaacgggcagttct |
52565338 |
T |
 |
| Q |
101 |
aacttaacaagcaactctaagcagattaagtttgaagatcaaaagcaaccactgtcaccacaaggaacagataatagcagcagcaataattattcaacta |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52565339 |
aacttaacaagcaactctaaacagattaagtttgaagatcaaaagcaaccactgtcaccacaaggaacagataatagcagcagcaataattattcaacta |
52565438 |
T |
 |
| Q |
201 |
ttagggtttgctctgattgcaacaccactaagacccctctctggaggagtggaccaagaggcccaaaggtatacatat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52565439 |
ttagggtttgctctgattgcaacaccactaagacccctctctggaggagtggaccaagaggcccaaaggtatacatat |
52565516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 201 - 257
Target Start/End: Complemental strand, 16954833 - 16954777
Alignment:
| Q |
201 |
ttagggtttgctctgattgcaacaccactaagacccctctctggaggagtggaccaa |
257 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||||||||| |||||||||| |
|
|
| T |
16954833 |
ttagggtttgtactgattgccacacaactaagacccctctctggagaagtggaccaa |
16954777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University