View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8169_high_19 (Length: 237)
Name: NF8169_high_19
Description: NF8169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8169_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 11 - 219
Target Start/End: Complemental strand, 39300209 - 39300001
Alignment:
| Q |
11 |
gtgagatgaacaaagatcatgcaggaaaagccattggagatattggtggaagaggaagatcaagagagactcatgaacttggttcaaatgtgaagcagag |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300209 |
gtgaaatgaacaaagatcatgcaggaaaagccattggagatattggtggaagaggaagatcaagagagactcatgaacttggttcaaatgtgaagcagag |
39300110 |
T |
|
| Q |
111 |
tgatagggatcatcatcatgctgctgctaccaaccttggacacaaacaaggttttcagtctcactctgatcaaaatgtgaaacagagtgagagggatcgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39300109 |
tgatagggatcatcatcatgctgctgctacgaaccttggtcacaagcaaggttttcagtctcactctgatcaaaatgtgaaacagagtgagagggatcgt |
39300010 |
T |
|
| Q |
211 |
catcatgct |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
39300009 |
catcatgct |
39300001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 39299940 - 39299888
Alignment:
| Q |
46 |
ggagatattggtggaagaggaagatcaagagagactcatgaacttggttcaaa |
98 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
39299940 |
ggagatattggtggaagaggaagagaaagagagagccatgaacttggttcaaa |
39299888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University