View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8169_low_12 (Length: 336)
Name: NF8169_low_12
Description: NF8169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8169_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 325
Target Start/End: Original strand, 7165623 - 7165926
Alignment:
| Q |
19 |
cttgaagtattaaccaccaatcaaccatttgttttacttctcaaccaccattatcaccaaaattttaattcacttttatccttttcgtcgtgtcacaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7165623 |
cttgaagtattaaccaccaatcaaccatttgttttacttctcaaccaccattatcaccaaaattttaattcacttttatcattttcgtcgtgtcacaatc |
7165722 |
T |
 |
| Q |
119 |
gttaatactatataaagcttttgtcaaaaaactataactaaaaattatttatggtcaaatgtgatcaataccatctcaatctcatttacgtagatattta |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7165723 |
gttaatactatataaagcttttgtcaaaaaactataactgaaaa----ttatggtcagatgtgatcaataccatctcaatctcatttacgtagatattta |
7165818 |
T |
 |
| Q |
219 |
aaacttagatatctttagcttgtcattaacccttt-nnnnnnntagttgtgacatccatgtcatcaccatctttaccacctaggtacctattccctgttc |
317 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||| | |
|
|
| T |
7165819 |
aaacttagatatctatagcttgtcattaaccctttaaaaaaaatagttgtgacatccatgtcatcaccatctttgccacctaggtacctattcactgtcc |
7165918 |
T |
 |
| Q |
318 |
ttctcact |
325 |
Q |
| |
|
|| ||||| |
|
|
| T |
7165919 |
ttatcact |
7165926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University