View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8169_low_15 (Length: 311)
Name: NF8169_low_15
Description: NF8169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8169_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 47320244 - 47320521
Alignment:
| Q |
19 |
tactttgttgagtgcgaattctttaaactataca-tttacatcaagtgcatagagattgaatcagatggtattttcgtagcacaactcatcttgaaattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47320244 |
tactttgttgagtgcgaattctttaaactatacactttacatcaagtgcatagagattgaatcagatggtattttcatagcacaactcatcttgaaattt |
47320343 |
T |
 |
| Q |
118 |
tcgatctttctgtctttacataatacaagaaagatgtttataattttcactataagatttggaaacagaatgaatcacattcaatagttgttaaaaaatg |
217 |
Q |
| |
|
|||||||||||||||| | |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47320344 |
tcgatctttctgtcttaa-ataatacaggaaagatgtttataattttcactataagatttggaaacagaatgaatcacattcaatagttgttaaaaaatg |
47320442 |
T |
 |
| Q |
218 |
gatatgattggttgacctgatacctacagcaagtagtgtgtttacaacaagtacgtagaattgtatcaattgatattca |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47320443 |
gatatgattggttgacctgatacctacagcaagtagtgtgtatacaacaagtacgtagaattgtatcaattgatattca |
47320521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University