View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8169_low_17 (Length: 294)
Name: NF8169_low_17
Description: NF8169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8169_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 23 - 116
Target Start/End: Complemental strand, 29570643 - 29570550
Alignment:
| Q |
23 |
aacatatacaagctcaaatatttcatacttgctcataatcaaaatgcataattaaaaatatttcacatcttaaatgcttgatttcattgtcttt |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29570643 |
aacatatacaagctcaaacatttcatacttgctcataatcaaaatgcataattaaaactatttcacatcttaaatgcttgatttcattgtcttt |
29570550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 183 - 275
Target Start/End: Complemental strand, 29570483 - 29570391
Alignment:
| Q |
183 |
tgctgtttattattgtgaaggctagcagaaacaccgatttaacccaattttcttcggcagctaactaccacaggttaaaatccatcggcagtt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||||||||||||| |||||| |
|
|
| T |
29570483 |
tgctgtttattattgtgaaggctagcagaaacaccaatttaacccaattttcttcggcagctaactaccgccggttaaaatccatcagcagtt |
29570391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 225 - 275
Target Start/End: Complemental strand, 19401795 - 19401745
Alignment:
| Q |
225 |
cccaattttcttcggcagctaactaccacaggttaaaatccatcggcagtt |
275 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
19401795 |
cccaattttcttcggcagttaactaccgtcggttaaaatctatcggcagtt |
19401745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University