View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8169_low_21 (Length: 245)

Name: NF8169_low_21
Description: NF8169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8169_low_21
NF8169_low_21
[»] chr1 (3 HSPs)
chr1 (82-223)||(46429219-46429360)
chr1 (161-205)||(46425927-46425971)
chr1 (48-78)||(46429166-46429196)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 82 - 223
Target Start/End: Original strand, 46429219 - 46429360
Alignment:
82 tctattttcatgatcatcagttaaagaattattcattggaccatatttacataatcacaagaatgatatcgaatctttcaagtagaacaatgtaagttga 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46429219 tctattttcatgatcatcagttaaagaattattcattggaccatatttacataatcacaagaatgatatcgaatctttcaagtagaacaatgtaagttga 46429318  T
182 tggaaaagaaaactacttactgtgagctaggcaattttaatg 223  Q
    ||||||||||||||||||||||||||||||||||||||||||    
46429319 tggaaaagaaaactacttactgtgagctaggcaattttaatg 46429360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 205
Target Start/End: Original strand, 46425927 - 46425971
Alignment:
161 aagtagaacaatgtaagttgatggaaaagaaaactacttactgtg 205  Q
    ||||||||||||| ||||||||||||||||| |||||| ||||||    
46425927 aagtagaacaatgaaagttgatggaaaagaagactactcactgtg 46425971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 78
Target Start/End: Original strand, 46429166 - 46429196
Alignment:
48 ttcaactgtcatacatggtagtttttgctaa 78  Q
    |||||||||||||||||||||||||||||||    
46429166 ttcaactgtcatacatggtagtttttgctaa 46429196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University