View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8169_low_23 (Length: 239)
Name: NF8169_low_23
Description: NF8169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8169_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 88 - 223
Target Start/End: Original strand, 35165638 - 35165773
Alignment:
| Q |
88 |
aaaatataaccaaattttaggagttgggcaacatttatcttttacgatcaaagatctacaaccttggcataaatttgttttttgatcatcaagttggata |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35165638 |
aaaatataaccaaattttaggagttgggcaacatttatcttttacgatcaaagatctacaaccttggcataaatttgttttttgatcatcaagttggata |
35165737 |
T |
|
| Q |
188 |
tttacaacgtagcttagatctagttgtagtgtgaac |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35165738 |
tttacaacctagcttagatctagttgtagtgtgaac |
35165773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University