View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8170_high_9 (Length: 245)
Name: NF8170_high_9
Description: NF8170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8170_high_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 245
Target Start/End: Original strand, 41141444 - 41141680
Alignment:
| Q |
14 |
acatcatgttcattataagttaccggaacagagaacatactttggtaggattatcaccataattcttaacagcaataggaactacgtctcggctgagtcc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41141444 |
acatcatgttcattataagttaccggaacagagaacatactttggtaggattatcaccataattcttaacagcaataggaactacgtctcggctgagtcc |
41141543 |
T |
 |
| Q |
114 |
catggctatatatttgttcacaattggatctgcagtagtaacctgcaaatatagtttcattttacaccatatgagttgg-----aaacaacagaagaatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41141544 |
catggctatatatttgttcacaattggatctgcagtagtaacctgcaaatatagtttcattttacaccatatgagttggaaaccaaacaacagaagaatt |
41141643 |
T |
 |
| Q |
209 |
ttatctatacacagaaaattaatgtactaaacatgaa |
245 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41141644 |
ttatctatacacagaaaattaatacactaaacatgaa |
41141680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University