View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8170_low_22 (Length: 234)

Name: NF8170_low_22
Description: NF8170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8170_low_22
NF8170_low_22
[»] chr1 (1 HSPs)
chr1 (53-100)||(32931918-32931965)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 53 - 100
Target Start/End: Original strand, 32931918 - 32931965
Alignment:
53 agaaatcatgaagtgattcttcaactatatataatgtgatttatcaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
32931918 agaaatcatgaagtgattcttcaactatatataatgtgatttatcaac 32931965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University