View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_high_20 (Length: 375)
Name: NF8172_high_20
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 33 - 366
Target Start/End: Original strand, 2355145 - 2355478
Alignment:
| Q |
33 |
agtttaacatgtctatactctagaattcagagcttaatcaataatgaaaggaggcacgtaaaaataaaactaaattgaagagttgccttgcagtagagag |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2355145 |
agtttaacatgtctatactctagaattcagagcttaatcaataacgaaaggaggcatgtaaaaataaaactaaattgaagagttgccttgtagtagagag |
2355244 |
T |
 |
| Q |
133 |
atttaccgcatttgcatcgtgattgtcaatgcctgggattgatgtaacaactttaaggtaaaagttcattccttgcaccaactgcttcctcttcaaaacc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355245 |
atttaccgcatttgcatcgtgattgtcaatgcctgggattgatgtaacaactttaaggtaaaagttcattccttgcaccaactgcttcctcttcaaaacc |
2355344 |
T |
 |
| Q |
233 |
ataacaaaatttaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctc |
332 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2355345 |
ataacaaaattcaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctc |
2355444 |
T |
 |
| Q |
333 |
acctcagccttcagtttttcttcaattctctgct |
366 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
2355445 |
acctcagctttcagtttttcttcaattctctgct |
2355478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 238 - 366
Target Start/End: Complemental strand, 2222689 - 2222561
Alignment:
| Q |
238 |
aaaatttaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctcacctc |
337 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2222689 |
aaaattcaaacatcaatttgctagtttcacttcatatgtgattagtagcagctaaatagtatgaaattttattgtaaaatcaatgagctgacctcacctc |
2222590 |
T |
 |
| Q |
338 |
agccttcagtttttcttcaattctctgct |
366 |
Q |
| |
|
||| ||||||||||||||||||||||||| |
|
|
| T |
2222589 |
agctttcagtttttcttcaattctctgct |
2222561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University