View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_high_27 (Length: 326)
Name: NF8172_high_27
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 102 - 246
Target Start/End: Complemental strand, 4575649 - 4575505
Alignment:
| Q |
102 |
aaaatatgatcacaattgttggtcttatgtgttggacattaaacacacctttaatttaaaatgtcggtgctacaaaggtttgtaacgtacaattgatttc |
201 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4575649 |
aaaatatgatcacaattgttggtcctatgtgttggacattaaacacacctttaatttaaaatgtcggtgctacaaaggtttgtaacgtacaattgatttc |
4575550 |
T |
 |
| Q |
202 |
ttacgcattgaccgtgtatatgatttgaatccacgaattaatgca |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4575549 |
ttacgcattgaccgtgtatatgatttgaatccatgaattaatgca |
4575505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 10 - 118
Target Start/End: Complemental strand, 4575772 - 4575664
Alignment:
| Q |
10 |
gaagcagagagagatacacaacactcatccatcaatatcgataataatttaagaaaatgagttgataaagtataatcacannnnnnnacaataaaatatg |
109 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4575772 |
gaagcacagagacatacacaacactcatccatcaatatcgataataatttaagaaaatgagttgataaagtataatcacatttttttacaataaaatatg |
4575673 |
T |
 |
| Q |
110 |
atcacaatt |
118 |
Q |
| |
|
||||||||| |
|
|
| T |
4575672 |
atcacaatt |
4575664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 268 - 310
Target Start/End: Complemental strand, 4575482 - 4575440
Alignment:
| Q |
268 |
ccagtattcaagaggcctttttcattattcaagaggtcttttt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4575482 |
ccagtattcaagaggcctttttcattattcaagaggtcttttt |
4575440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 180
Target Start/End: Complemental strand, 54083910 - 54083857
Alignment:
| Q |
127 |
tatgtgttggacattaaacacacctttaatttaaaatgtcggtgctacaaaggt |
180 |
Q |
| |
|
||||||||| ||||||| ||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
54083910 |
tatgtgttgaacattaatcacgtctttaattaaaagtgtcggtgctacaaaggt |
54083857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 29 - 69
Target Start/End: Original strand, 29711248 - 29711288
Alignment:
| Q |
29 |
aacactcatccatcaatatcgataataatttaagaaaatga |
69 |
Q |
| |
|
||||||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
29711248 |
aacactcatgcatcaacatcgataataatttgagaaaatga |
29711288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University