View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8172_high_29 (Length: 316)

Name: NF8172_high_29
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8172_high_29
NF8172_high_29
[»] chr8 (2 HSPs)
chr8 (13-128)||(43449892-43450007)
chr8 (221-297)||(43449723-43449799)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 43450007 - 43449892
Alignment:
13 gagatgaaaacaaaaaagatgctcgtagagagacggtgctatttcagatcgagcgagtgaaggattggaatgaaagattctgaggagaatgatggcagat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43450007 gagatgaaaacaaaaaagatgctcgtagagagacggtgctatttcagatcgagcgagtgaaggattggaatgaaagattctgaggagaatgatggcagat 43449908  T
113 tcttcggcgtggttac 128  Q
    ||||||||||||||||    
43449907 tcttcggcgtggttac 43449892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 221 - 297
Target Start/End: Complemental strand, 43449799 - 43449723
Alignment:
221 cgaatggcggagctggagttggaaacggcgctttcgagagcttctgaggcgaggttgagttgttttaaggttacttg 297  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43449799 cgaatggcggagctggagttggaaacggcgctttcgagagcttctgaggcgaggttgagttgttttaaggttacttg 43449723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University