View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_high_42 (Length: 254)
Name: NF8172_high_42
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_high_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 40452521 - 40452757
Alignment:
| Q |
1 |
agtataatcaaacacacaatattaacgaactaccgaaccccttaacaaattggccaaaacaggttgtcaaaaactctatatttgtccttcaatttagtcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40452521 |
agtataatcaaacacacaatattaacgaactaccgaaccccttaacaaattggccaaaacaggttgtcaaaaactctatatttgtccttcaatttagtcc |
40452620 |
T |
|
| Q |
101 |
attacttgttaacttacgcaacgaggctcgttaatcaaaatacacaccaacttaatccttttgcaatcaaaattcacctcatatggagcataatttatga |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40452621 |
attacttgttaacttatgcaacgaggctcgttaatcaaaatacacaccaacttaatacttttgcaatcaaaattcacctcatatggagcataatttatga |
40452720 |
T |
|
| Q |
201 |
aaattatgagtgagtcattaagaaacaaacttgattt |
237 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
40452721 |
aaattatgagtgagtcgttaagaaacaaaattgattt |
40452757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University