View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_high_57 (Length: 208)
Name: NF8172_high_57
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_high_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 12 - 188
Target Start/End: Complemental strand, 4570606 - 4570430
Alignment:
| Q |
12 |
gagatgaataatgagagaaaatatcatgctgttgggtgggacaaagtcgttaagcttaaagagttgggtggtttaggtcttcatcggctcgatataatga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4570606 |
gagatgaataatgagagaaaatatcatgcagttgggtgggacaaagtcgttaagcttaaagagttgggtggtttaggtcttcgtcggctcgatataatga |
4570507 |
T |
|
| Q |
112 |
acaaggcttgcttgtattctaaagttgggttggaaacttcagatcggtactaatgatctttagacagaggtgatgtg |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4570506 |
acaaggcttgcttgtattctaaagttgggttggaaacttcagatcggtactaatgatctttagacagaggtgatgtg |
4570430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University