View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_low_26 (Length: 337)
Name: NF8172_low_26
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 166 - 321
Target Start/End: Complemental strand, 19227889 - 19227734
Alignment:
| Q |
166 |
agagtgccatatttaaaccagtgtttaaactagatatagatgtccccaaaatc-accctgcactcaaacctgccatatttattgcatagcaaagcattgt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19227889 |
agagtgccatatttaaaccagtgtttaaaccagatatagatgtccccaaaatccaccctgcactcaaacctgccatatt-attgcatagcaaagcattgt |
19227791 |
T |
 |
| Q |
265 |
tggagtctctagctttctgtaaaccaagacccctaaggttctctgaatgagcaatct |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19227790 |
tggagtctctagctttctgtaaaccaagacccccaaggttctctgaatgagcaatct |
19227734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 16 - 128
Target Start/End: Complemental strand, 19228041 - 19227929
Alignment:
| Q |
16 |
tgaaaagaatttgaggtttgagggtaactggattgatgctgatatcaaatttgacagactcaagaatggaggtatagagaaagttcaaatcacagtttcc |
115 |
Q |
| |
|
||||||||| ||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19228041 |
tgaaaagaacttgaggtttgagggtaactagtttgatgctgatatcaaatttgatagactcaagaatggaggtatagagaaagttcaaatcacagtttcc |
19227942 |
T |
 |
| Q |
116 |
atcattgatgatg |
128 |
Q |
| |
|
||||||||||||| |
|
|
| T |
19227941 |
atcattgatgatg |
19227929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University