View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_low_32 (Length: 316)
Name: NF8172_low_32
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 43450007 - 43449892
Alignment:
| Q |
13 |
gagatgaaaacaaaaaagatgctcgtagagagacggtgctatttcagatcgagcgagtgaaggattggaatgaaagattctgaggagaatgatggcagat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43450007 |
gagatgaaaacaaaaaagatgctcgtagagagacggtgctatttcagatcgagcgagtgaaggattggaatgaaagattctgaggagaatgatggcagat |
43449908 |
T |
 |
| Q |
113 |
tcttcggcgtggttac |
128 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
43449907 |
tcttcggcgtggttac |
43449892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 221 - 297
Target Start/End: Complemental strand, 43449799 - 43449723
Alignment:
| Q |
221 |
cgaatggcggagctggagttggaaacggcgctttcgagagcttctgaggcgaggttgagttgttttaaggttacttg |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43449799 |
cgaatggcggagctggagttggaaacggcgctttcgagagcttctgaggcgaggttgagttgttttaaggttacttg |
43449723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University