View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_low_43 (Length: 263)
Name: NF8172_low_43
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_low_43 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 120 - 263
Target Start/End: Complemental strand, 24176062 - 24175919
Alignment:
| Q |
120 |
cttctatctcatttgggaaaaatgatacaaacatggaaacctaagaataaacaaaaaactaaagccacttgacattgaactaaaagtaaattgtaattgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
24176062 |
cttctatctcatttgggaaaaatgatacaaacatggaaacctaagaataaacaaaaaactaaaggcacttgacattggactaaaagtaaattgtaattgc |
24175963 |
T |
 |
| Q |
220 |
aatcacgcgattgcaattacataataaatattcatattgcagga |
263 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
24175962 |
aatcgcgcgattgcaattacataataaatcttcatattgcagga |
24175919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 24176106 - 24176059
Alignment:
| Q |
1 |
caacatatatcaatttcatttcacatttgcagttcccatgttttcttc |
48 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24176106 |
caacatataaaaatttcatttcacatttgcagttcccgtgttttcttc |
24176059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University