View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8172_low_46 (Length: 256)
Name: NF8172_low_46
Description: NF8172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8172_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 245
Target Start/End: Complemental strand, 29202858 - 29202631
Alignment:
| Q |
18 |
gatcaggttttaagctatgagcttcgcatgatatttcccgtgaaaggtttagatcatccgcaacaaaagtattgtcaggagcaaggtcaagcatatcttc |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29202858 |
gatcaggttttaagctatgagcctcgcatgatatttcccgtgaaaggtttagatcatccgcaacaaaagtattgtcaggagcaaggtcaagcatatcttc |
29202759 |
T |
|
| Q |
118 |
agagcatctagatgacatgttatttctttctagagataactcattgaactcttcatgcaaacttgatgttggtgtcaaggaatcaagtaacatttcaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29202758 |
agagcatctagatgacatgttatttctttctagagataactcattgaactcttcatgcaaacttgatgttggtgtcaaggaatcaagtaacatttcaatt |
29202659 |
T |
|
| Q |
218 |
gtttcggcaactctttcaagccgttcat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29202658 |
gtttcggcaactctttcaagccgttcat |
29202631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 12649029 - 12649256
Alignment:
| Q |
18 |
gatcaggttttaagctatgagcttcgcatgatatttcccgtgaaaggtttagatcatccgcaacaaaagtattgtcaggagcaaggtcaagcatatcttc |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12649029 |
gatcaggttttaagctatgagcctcgcatgatatttcccgtgaaaggtttagatcatccgcaacaaaagtattgtcaggagcaaggtcaagcatatcttc |
12649128 |
T |
|
| Q |
118 |
agagcatctagatgacatgttatttctttctagagataactcattgaactcttcatgcaaacttgatgttggtgtcaaggaatcaagtaacatttcaatt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12649129 |
agagcatctagatgacatgttatttctttctagagataactcattgaactcttcatgcaaacttgatgttggtgtcaaggaatcaagtaacatttcaatt |
12649228 |
T |
|
| Q |
218 |
gtttcggcaactctttcaagccgttcat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12649229 |
gtttcggcaactctttcaagccgttcat |
12649256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University